Below, draw the resulting DNA after Tn/0 has transposed into it, showing the Tn10 by a rectangle (blunt ended DNA) and the target site duplication clearly indicated by arrows

/in /by

15. (2 pts) Tn/0 is a cut-and-paste (conservative) transposon. Assume that the target DNA site below is cut by Tn/0 transposa
15. (2 pts) Tn/0 is a cut-and-paste (conservative) transposon. Assume that the target DNA site below is cut by Tn/0 transposase as shown below by arrows 5′ GGACTAGGTTTAGCCTCCACT CCTGATCCAAATCGGAGGTGA Below, draw the resulting DNA after Tn/0 has transposed into it, showing the Tn10 by a rectangle (blunt ended DNA) and the target site duplication clearly indicated by arrows.

 

Save your time - order a paper!

Get your paper written from scratch within the tight deadline. Our service is a reliable solution to all your troubles. Place an order on any task and we will take care of it. You won’t have to worry about the quality and deadlines

Order Paper Now

The post Below, draw the resulting DNA after Tn/0 has transposed into it, showing the Tn10 by a rectangle (blunt ended DNA) and the target site duplication clearly indicated by arrows appeared first on nursing assignment tutor.