Instructions:

-Please read each multiple choice, true/false, or short answer question carefully. Answer short-answer questions completely but please be concise. Points maybe deducted for excessive wordiness or if additional information not relevant to the question is given.

-Highlight the correct answer for multiple choice questions in yellow. Also highlight all other answers (short answer, True/False, etc) in yellow.

– You could use the attched “Merged lectures” as a source, or you could use you own sources.

Questions:

1. List the following in order from smallest to largest based on size of the molecule, region or structure: 1p, 6q26, base pair, chromosome 1, chromosome 22, codon, diploid human genome, exon, gene, haploid human genome, intron, nucleoside, nucleotide, purine base, pyrimidine base
2. Translation starts and finishes within the portion of the mRNA sequence below from the hypothetical gene, XYZ. Give the predicted amino acid sequence (single-letter or three-letter abbreviations).

CUUGAAUUCUUUGAACGAACAUCGAUGAGUGUUCCAAGAGGGGCACUUCAUCACUAGUCUACCGUCUAU

1. The gene above is sequenced in a patient A and patient B, both suspected of having a genetic disease caused by mutations in this gene. Describe the variant/mutation found in each patient and classify each with using the following terms when appropriate (SNV, CNV, nonsense, missense, silent, frameshift, in-frame, deletion, insertion, transition, transversion, inversion, translocation, trisomy, monosomy, amplification)

patient A:

CTTGAATTCTTTGAACGAACATCGATGAGTGTTCCATGAGGGGCACTTCATCACTAGTCTACCGTCTAT

patient B:
CTTGAATTCTTTGAACGAACATCGATGAGTGTTCCACGAGGGGCACTTCATCACTAGTCTACCGTCTAT

1. Based on the information provided in the previous question, is it more likely that patient A or patient B has the genetic disease associated with XYZ? Why?

1. At a particular locus, how many alleles could you have in common with a sibling (same biological parents)?
   1. 1
   2. 2
   3. 1 or 2
   4. 0, 1 or 2

1. List three components or molecules needed for transcription.
2. List three ways RNA differs from DNA.

1. Which best describes “redundancy” of the genetic code?
   1. all organism use the same genetic code
   2. a single amino acid can be coded for by multiple codons
   3. the use of RNA as an intermediate in the genetic code evolved separately in different organisms
   4. The same nucleotide is often repeated several times in the exons of protein coding genes

1. Which components can be found within exons?
   1. stop codons and introns
   2. promoters and start codons
   3. polyadenylation signal and stop codon
   4. poly-A tail and 5’ untranslated region

• Which could be found in an intron?
  1. missense mutation
  2. benign SNV
  3. nonsense mutation
  4. stop codon

• Describe the difference between a missense and frameshift variant. What is the impact of each on the DNA sequence and protein sequence?
• Which term could be used to describe the variant, “c.135A>C”?
  1. silent
  2. deletion
  3. transition
  4. inversion

• Sequencing of cancer tissue reveals a somatic variant/mutation involving a tumor suppressor gene. Which term would most likely describe this variant?
  1. deletion
  2. amplification
  3. silent
  4. chimeric

• DNA is extracted from two peripheral whole blood specimens and evaluated by UV spectrophotometry. Give the absorbance measurements below, which sample might be less suitable for PCR testing?
  1. sample #1: 260 nm = 0.85;  280 nm = 1.6
  2. sample #2: 260 nm = 0.61;  280 nm = 0.32

• What explanation gives the most convincing explanation for the condition of the less suitable DNA sample in the previous question?
  1. Storage of the DNA samples for more than one month at room temperature
  2. Exposure of the sample to ionizing radiation
  3. Contaminating RNA
  4. Eluting DNA with too much TE buffer
  5. Insufficient washing of magnetic beads during DNA extraction

• All of the following are required for both PCR and Southern blotting EXCEPT:
  1. enzyme
  2. hybridization
  3. target amplification
  4. DNA being tested

• In traditional (endpoint) PCR, why is testing usually not finished immediately after thermal cycling?

• A PCR is performed to amplify a target sequence in genomic DNA prior to Sanger sequencing for 200 different patient samples. The PCR works as expected for all but one sample (John Doe) in which the target sequence did not amplified. Which explanation makes most sense?
  1. John Doe’s DNA sample was isolated from blood drawn in a sodium heparin (green-top) tube.
  2. John Doe’s DNA sample was isolated from frozen tissue
  3. John Doe’s DNA sample became contaminated with PCR product (amplicon) from the last time the same PCR was run
  4. A negative control was not run

• List 3 ways the set-up and running of real-time PCR differs from traditional/endpoint PCR.

• List 3 things real-time PCR and traditional/endpoint PCR have in common.

• List 3 benefits of real-time PCR over traditional PCR.

• Give the values from figure above:
  1. Ct: _________
  2. threshold: __________
  3. Number of PCR cycles: ________
• Which is true of real-time PCR with Taqman probes?
  1. It requires a polymerase with 5’-3’ endonuclease activity
  2. Two different oligonucleotide probes are required
  3. Increased specificity over SYBR green real-time PCR
  4. All of the above

• Which is true of performing real-time PCR with SYBR green?
  1. besides the two primers, no other oligonucleotides are needed
  2. it requires fluorescent detection
  3. it can be cheaper than other real-time PCR methods
  4. All of the above

• A couple has a child with cystic fibrosis and later has another child that does not have cystic fibrosis. What is the probability the second child is a carrier?
  1. 100%
  2. 66%
  3. 50%
  4. 25%
  5. 0%
• A newborn child is diagnosed with cystic fibrosis and Tay Sachs disease, two autosomal recessive diseases. Both parents are evaluated and neither has symptoms of either disease. Which scenario best explains the child’s condition?
  1. Neither parent harbors mutations for cystic fibrosis or Tay Sachs. The mutations in the child occurred de novo.
  2. Both parents are compound heterozygotes.
  3. Both parents are double heterozygotes.
  4. The child is male and the genes mutated are both on the X chromosome.

• If a man in known to be a carrier for the deltaF508 mutation in the CFTR gene and his partner is tested for the deltaF508 mutation and it is not detected, the couple can be assured they won’t have a child with cystic fibrosis.
  1. True
  2. False

• The xTAG Cystic Fibrosis Assay uses a multiplex PCR because
  1. the CFTR gene is so large
  2. the assay must detect a large number of mutations
  3. CFTR mutations are relatively common in the Caucasian population
  4. there are a large number of pathogenic organisms that tend to colonize the lungs of CF patients

• Recently, several rapid, single sample molecular tests have been approved for infectious disease testing but this trend does not seem to be as common for genetic testing. Why?
  1. Bacteria and viruses replicate quickly making them easier to detect by PCR than human genomic targets.
  2. DNA from microbes has more repetitive sequences which makes it a better target for PCR.
  3. Microbial genomes are generally much smaller than the human genomes.
  4. Reporting results in hours instead of days for genetic testing does not impact patient care as much as for molecular infectious disease testing.

• BG2 is a human gene that is used as an internal control in the GeneXpert MRSA PCR. The reason that BG2 is used is…
  1. To ensure proper specimen collection and help rule-out a false-negative due to PCR inhibitors
  2. to distinguish human specimens from animal specimens since MRSA infections are common in pets and farm animals
  3. the test is performed in a single-sample cartridge. Separate MRSA-positive batch controls are not possible.
  4. to make the test quantitative

• Which statement is true concerning HPV and cervical cancer
  1. All HPV infections lead to cervical cancer
  2. All cervical cancers are associated with HPV
  3. HPV-associated cervical cancer is more deadly than cervical cancer not associated with HPV
  4. HPV 6, 11, 42, 43 and 44 are most closely associated with cervical cancer

• Quantitative viral testing…
  1. is rarely clinically relevant
  2. can be performed by real-time PCR with a standard curve
  3. is possible with real-time PCR but rarely uses Ct values
  4. is possible with real-time PCR but require SYBR green
• All of the following are associated with microarrays EXCEPT:
  1. probes
  2. multiplexing
  3. hybridization
  4. real-time PCR

• Which is not a common application of microarray technology
  1. Next generation sequencing
  2. genotyping
  3. gene expression
  4. CNV detection

• What is one advantage that chromosomal microarrays (CMAs) have over traditional karyotype?
  1. higher resolution
  2. better detection of translocations
  3. fewer variants of uncertain significance
  4. can detect novel point mutations

• List 4 abnormalities that can be detected with SNP-based CMAs.

• Why is there a shift from three tracks to two in the allele peaks (SNP data) in the CMA data shown below?
• Long stretches of homozygosity detected by a SNP-based CMA could indicate all of the following EXCEPT
  1. consanguinity
  2. chimerism
  3. uniparental disomy
  4. risk for autosomal recessive diseases
• A Sanger sequencing reaction includes many of the same components as PCR. In which ways are the two similar?
  1. ddNTPs
  2. exponential amplification
  3. two primers per reaction
  4. thermal cycling
  5. all of the above

• A germline mutation can be detected in
  1. sperm or eggs
  2. blood
  3. breast tissue
  4. tumor tissue
  5. all of the above
• An increased depth of coverage in next-generation sequencing is generally associated with
  1. more genes being sequenced
  2. increased sensitivity for low-level variants
  3. sequencing all the exons in a gene
  4. increased rates of false-positives
• At a given position in an exon included in a next-generation sequencing panel, the nucleotide G is detected in 1483 reads and ‘A’ is detected in 164 reads. The ‘A’ allele is most likely…
  1. a germline variant
  2. a somatic variant
  3. part of a microbial genome sequence
  4. benign
• Next-generation sequencing reveals a variant in an unfamiliar gene. What should you do to better understand the variant?
  1. Determine the effect of the variant on the gene and its protein
  2. Check OMIM.org for information about the gene and its function
  3. Search PubMed for articles on the gene and variant
  4. Query databases to see if the variant has been seen previously in normal or affected individuals
  5. all of the above
• CLIA is an organization with many responsibilities, including assisting the FDA decide which laboratory tests should be reimbursed by Medicare.
  1. True
  2. False
• CAP and The Joint Commission are two organizations that can certify clinical labs.
  1. True
  2. False

• Proficiency testing is…
  1. required for high complexity testing only
  2. is required for CAP-certified labs only
  3. performed when validating tests and when controls fall out of range
  4. mandated by CLIA
• Waived tests…
  1. Do not need to be reviewed by the FDA before they are sold commercially
  2. include most lab-developed tests
  3. must be performed by someone with a bachelor’s degree or higher
  4. all of the above
  5. none of the above
• CAP inspects laboratories based on regulations specified in CLIA.
  1. True
  2. False
• What organization determines test complexity?
  1. FDA
  2. CLIA
  3. CLIAC
  4. CMS

• CLIA addresses all of the following EXCEPT…
  1. requirements for report format
  2. lab design
  3. proficiency testing
  4. requirements for IVDs being submitted as PMA
  5. educational requirements for medical directors

• Enforcement discretion refers to…
  1. FDA’s decisions to inspect some labs on an annual basis and others less frequently
  2. FDA oversight of lab developed tests
  3. CLIA’s decisions to penalize labs for failed proficiency testing
  4. FDA’s policy not to interfere with labs that decide to sell test reagents to other labs
• Which of the following is not a medical device
  1. MRI instrument
  2. home pregnancy test
  3. chemotherapy agent
  4. catheter

• An IVD that is FDA-cleared
  1. is also FDA-approved
  2. was found perform similar to and FDA-approved IVD
  3. went through a more extensive clinical trial than and FDA-approved IVD
  4. must have had a clinical trial comparing patient test results to their clinical data

• A monoclonal antibody
  1. is will bind multiple epitopes
  2. is purified from serum of animals
  3. requires fused cells
  4. all of the above

• In competitive immunoassays the
  1. product measured is inversely proportional to the antigen concentration
  2. product measured is proportional to the antigen concentration
  3. hook effect can be seen when the product is present at low concentrations

none of the above

Psych 301, Biological Bases of Behavior, Common Exam, Version A 

Section: Multiple ChoiceThere are 50 multiple choice questions (50 points). Choose the one alternative that best completes the statement or answers the question.   Use Answer Sheet Document to enter answers

1.	Which of the following statements is consistent with how a behavioral neuroscientist (physiological psychologist, biopsychologist) would solve the mind-body problem?

	A	)	The mind is a product produced by the operations of the nervous system.
	B	)	The body can influence the mind through the actions of the pineal gland.
	C	)	The mind is spiritual, while the body is made from matter.
	D	)	The mind can exist apart from the body
	E	)	The body is physical, but the mind is not.

2.	The key property of addictive drugs relates to

	A	)	their ability to inhibit dopamine in brain.
	B	)	the withdrawal that follows termination of the drug.
	C	)	their reinforcing effects.
	D	)	their capacity to produce tolerance.
	E	)	their ability to rapidly produce physical dependence.

3.	Behavioral Neuroscience (Biopsychology, Physiological Psychology) emphasizes that

	A	)	success in the neurosciences depends on cooperation among its many disciplines.
	B	)	the discipline of neuroscience mostly focuses on the relation between the nervous system and behavior.
	C	)	it comprises several subdivisions, each of which favors a different research approach.
	D	)	failure to follow the basic principles of scientific inquiry can lead to potentially dangerous conclusions
	E	)	all of the above.

4.	Which is NOT an important principle of the study devoted to the biological bases of behavior (behavioral neuroscience, psychobiology, physiological psychology):

	A	)	The Nervous System controls and responds to body functions and directs behavior
	B	)	Nervous System structure and function are determined by both genes and environment throughout life
	C	)	Every behavior can be explained solely by reference to the brain
	D	)	The brain Is the foundation of the mind making learning, memory, language and other processes possible
	E	)	Research leads to understanding that is essential for development of therapies for Nervous System disorders

5.	The main reason why Long Term Potentiation (LTP) is one of the most widely studied neuroscientific phenomena is that it

	A	)	involves a synaptic change similar to the synaptic change that has been hypothesized to be the basis of memory storage.
	B	)	can easily be studied in humans.
	C	)	involves readily accessible neocortical circuits
	D	)	occurs only in mammals.
	E	)	can be induced by both electrical and chemical stimulation.

6.	Stages of sleep are easily distinguished by

	A	)	changes in respiration.
	B	)	the quality and quantity of dreams.
	C	)	changes in the electrical activity of the brain.
	D	)	changes in consciousness.

7.	A person is asked to take part in an experiment that is examining brain areas associated with changes in verb generation and mathematical problem solving. Which of these techniques are the experimenters likely to use

	A	)	Computed Tomography
	B	)	Magnetic Resonance Imaging
	C	)	Electroencephalogam
	D	)	Functional Magnetic Resonance Imaging
	E	)	Diffusion Tensor Imaging

8.	Which of the following is NOTan advantage for using non-human animals in biopsychological research:

	A	)	Brains of animals are less complex
	B	)	There are fewer ethical constraints on nonhuman animal research
	C	)	Models of several species makes comparative research possible
	D	)	They can not provide information about any human cognitive process

9.	Study of the function of the living human brain is difficult for all the following reasons,EXCEPT

	A	)	it is unethical to induce brain damage in humans for the purpose of research.
	B	)	brain damage is rarely the same from case to case.
	C	)	it is difficult to obtain the brain of a person who has suffered brain damage.
	D	)	researchers have to wait for the natural death of a brain-damaged human to verify the location of the brain damage.
	E	)	a damaged brain gives us little information about brain structure and function in the living brain.

10.	EEG recordings of human brain activity provide all the following information,EXCEPT

	A	)	monitoring brain function during brain surgery.
	B	)	diagnosis of epilepsy.
	C	)	study of sleep cycles.
	D	)	study of wakefulness.
	E	)	pure view of neural activity.